August 5, 2021

Modulus of heat-set globular protein gels.

The affect of electrostatic interplay on the construction and the shear modulus of heat-set globular protein gels.

Gels fashioned by the globular protein β-lactoglobulin after warmth denaturation had been studied utilizing gentle scattering, turbidity and shear oscillation measurements.
The construction of the gels was characterised when it comes to the amplitude and the correlation size of focus fluctuations. The energy of electrostatic interactions was diverse by altering the pH within the absence of added salt or by altering the NaCl focus at pH 7.
A really sturdy improve of the heterogeneity of the gels was noticed when lowering the pH in direction of the isoelectric level or when growing the salt focus.
The structural change was interpreted when it comes to a lower of the online repulsion between the rising aggregates resulting in elevated focus fluctuations and at last microscopic part separation. The elastic shear modulus elevated with lowering pH and confirmed a most as a perform of the NaCl focus. No direct correlation between the change within the construction and the elastic modulus was discovered.

The affect of electrostatic interplay on the construction and the shear modulus of heat-set globular protein gels.

Gels fashioned by the globular protein β-lactoglobulin after warmth denaturation had been studied utilizing gentle scattering, turbidity and shear oscillation measurements.
The construction of the gels was characterised when it comes to the amplitude and the correlation size of focus fluctuations. The energy of electrostatic interactions was diverse by altering the pH within the absence of added salt or by altering the NaCl focus at pH 7.
A really sturdy improve of the heterogeneity of the gels was noticed when lowering the pH in direction of the isoelectric level or when growing the salt focus. The structural change was interpreted when it comes to a lower of the online repulsion between the rising aggregates resulting in elevated focus fluctuations and at last microscopic part separation.
The elastic shear modulus elevated with lowering pH and confirmed a most as a perform of the NaCl focus. No direct correlation between the change within the construction and the elastic modulus was discovered.
PACSIN3 antibody
10R-5141 100 ul
EUR 726
Description: Mouse monoclonal PACSIN3 antibody
PACSIN3 antibody
10R-5142 100 ul
EUR 691
Description: Mouse monoclonal PACSIN3 antibody
PACSIN3 antibody
10R-5143 100 ul
EUR 691
Description: Mouse monoclonal PACSIN3 antibody
PACSIN3 antibody
10R-5144 100 ul
EUR 691
Description: Mouse monoclonal PACSIN3 antibody
PACSIN3 antibody
10R-5145 100 ul
EUR 691
Description: Mouse monoclonal PACSIN3 antibody
PACSIN3 antibody
10R-5146 100 ul
EUR 691
Description: Mouse monoclonal PACSIN3 antibody
PACSIN3 antibody
10R-5147 100 ul
EUR 691
Description: Mouse monoclonal PACSIN3 antibody
PACSIN3 antibody
10R-5148 100 ul
EUR 691
Description: Mouse monoclonal PACSIN3 antibody
PACSIN3 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PACSIN3. Recognizes PACSIN3 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:20-1:200
PACSIN3 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PACSIN3. Recognizes PACSIN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
PACSIN3 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PACSIN3. Recognizes PACSIN3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA26078 50 ul
EUR 334
Description: Mouse polyclonal to PACSIN3
Pacsin3 ORF Vector (Rat) (pORF)
ORF073049 1.0 ug DNA
EUR 506
PACSIN3 ORF Vector (Human) (pORF)
ORF007477 1.0 ug DNA
EUR 95
Pacsin3 ORF Vector (Mouse) (pORF)
ORF053297 1.0 ug DNA
EUR 506
Pacsin3 ORF Vector (Mouse) (pORF)
ORF053298 1.0 ug DNA
EUR 506
PACSIN3 Polyclonal Antibody
31620-100ul 100ul
EUR 252
PACSIN3 Polyclonal Antibody
31620-50ul 50ul
EUR 187
PACSIN3 cloning plasmid
CSB-CL892456HU-10ug 10ug
EUR 467
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1275
  • Sequence: atggctccagaagaggacgctggaggggaggccttagggggcagtttctgggaggctggcaactacaggcgcacggtacagcgggtggaggacgggcaccggctgtgcggggacctggtcagctgcttccaggagcgcgcccgcatcgagaaggcttatgcccagcagttggctg
  • Show more
Description: A cloning plasmid for the PACSIN3 gene.
PACSIN3 Rabbit pAb
A8647-100ul 100 ul
EUR 308
PACSIN3 Rabbit pAb
A8647-200ul 200 ul
EUR 459
PACSIN3 Rabbit pAb
A8647-20ul 20 ul
EUR 183
PACSIN3 Rabbit pAb
A8647-50ul 50 ul
EUR 223
anti- PACSIN3 antibody
FNab06102 100µg
EUR 548.75
  • Immunogen: protein kinase C and casein kinase substrate in neurons 3
  • Uniprot ID: Q9UKS6
  • Gene ID: 29763
  • Research Area: Neuroscience, Signal Transduction, Metabolism
Description: Antibody raised against PACSIN3
Anti-PACSIN3 antibody
PAab06102 100 ug
EUR 386
Anti-PACSIN3 antibody
STJ111362 100 µl
EUR 277
Description: This gene is a member of the protein kinase C and casein kinase substrate in neurons family. The encoded protein is involved in linking the actin cytoskeleton with vesicle formation. Alternative splicing results in multiple transcript variants.
Anti-PACSIN3 antibody
STJ70100 100 µg
EUR 359
PACSIN3 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PACSIN3. Recognizes PACSIN3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PACSIN3 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PACSIN3. Recognizes PACSIN3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PACSIN3 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PACSIN3. Recognizes PACSIN3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
PACSIN3 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PACSIN3. Recognizes PACSIN3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
PACSIN3 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PACSIN3. Recognizes PACSIN3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
PACSIN3 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PACSIN3. Recognizes PACSIN3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
ELI-14528h 96 Tests
EUR 824
EF001519 96 Tests
EUR 689
Mouse Pacsin3 ELISA KIT
ELI-45105m 96 Tests
EUR 865
Mouse PACSIN3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PACSIN3 Polyclonal Conjugated Antibody
C31620 100ul
EUR 397
Human PACSIN3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
PACSIN3 Recombinant Protein (Human)
RP022429 100 ug Ask for price
PACSIN3 Recombinant Protein (Mouse)
RP159887 100 ug Ask for price
PACSIN3 Recombinant Protein (Mouse)
RP159890 100 ug Ask for price
PACSIN3 Recombinant Protein (Rat)
RP219143 100 ug Ask for price
PACSIN3 Protein Vector (Rat) (pPB-C-His)
PV292194 500 ng
EUR 603
PACSIN3 Protein Vector (Rat) (pPB-N-His)
PV292195 500 ng
EUR 603
PACSIN3 Protein Vector (Rat) (pPM-C-HA)
PV292196 500 ng
EUR 603
PACSIN3 Protein Vector (Rat) (pPM-C-His)
PV292197 500 ng
EUR 603
PACSIN3 Protein Vector (Mouse) (pPB-C-His)
PV213186 500 ng
EUR 603
PACSIN3 Protein Vector (Mouse) (pPB-N-His)
PV213187 500 ng
EUR 603
PACSIN3 Protein Vector (Mouse) (pPM-C-HA)
PV213188 500 ng
EUR 603
PACSIN3 Protein Vector (Mouse) (pPM-C-His)
PV213189 500 ng
EUR 603
PACSIN3 Protein Vector (Mouse) (pPB-C-His)
PV213190 500 ng
EUR 603
PACSIN3 Protein Vector (Mouse) (pPB-N-His)
PV213191 500 ng
EUR 603
PACSIN3 Protein Vector (Mouse) (pPM-C-HA)
PV213192 500 ng
EUR 603
PACSIN3 Protein Vector (Mouse) (pPM-C-His)
PV213193 500 ng
EUR 603
PACSIN3 Protein Vector (Human) (pPB-C-His)
PV029905 500 ng
EUR 329
PACSIN3 Protein Vector (Human) (pPB-N-His)
PV029906 500 ng
EUR 329
PACSIN3 Protein Vector (Human) (pPM-C-HA)
PV029907 500 ng
EUR 329
PACSIN3 Protein Vector (Human) (pPM-C-His)
PV029908 500 ng
EUR 329
Polyclonal Goat Anti-PACSIN3 Antibody
APR16339G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-PACSIN3 . This antibody is tested and proven to work in the following applications:
Polyclonal PACSIN3 Antibody (N-term)
APR17734G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PACSIN3 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal Pacsin3 antibody - C-terminal region
APR17735G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Pacsin3 - C-terminal region. This antibody is tested and proven to work in the following applications:
Pacsin3 sgRNA CRISPR Lentivector set (Rat)
K6370001 3 x 1.0 ug
EUR 339
Pacsin3 sgRNA CRISPR Lentivector set (Mouse)
K3491501 3 x 1.0 ug
EUR 339
PACSIN3 sgRNA CRISPR Lentivector set (Human)
K1586901 3 x 1.0 ug
EUR 339
Pacsin3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6370002 1.0 ug DNA
EUR 154
Pacsin3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6370003 1.0 ug DNA
EUR 154
Pacsin3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6370004 1.0 ug DNA
EUR 154
Pacsin3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3491502 1.0 ug DNA
EUR 154
Pacsin3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3491503 1.0 ug DNA
EUR 154
Pacsin3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3491504 1.0 ug DNA
EUR 154
PACSIN3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1586902 1.0 ug DNA
EUR 154
PACSIN3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1586903 1.0 ug DNA
EUR 154
PACSIN3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1586904 1.0 ug DNA
EUR 154
Pacsin3 3'UTR Luciferase Stable Cell Line
TU115843 1.0 ml Ask for price
Pacsin3 3'UTR GFP Stable Cell Line
TU165843 1.0 ml Ask for price
Pacsin3 3'UTR GFP Stable Cell Line
TU265755 1.0 ml Ask for price
Pacsin3 3'UTR Luciferase Stable Cell Line
TU215755 1.0 ml Ask for price
PACSIN3 3'UTR GFP Stable Cell Line
TU067310 1.0 ml
EUR 1394
PACSIN3 3'UTR Luciferase Stable Cell Line
TU017310 1.0 ml
EUR 1394
Pacsin3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6370005 3 x 1.0 ug
EUR 376
Pacsin3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3491505 3 x 1.0 ug
EUR 376
PACSIN3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1586905 3 x 1.0 ug
EUR 376
Pacsin3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6370006 1.0 ug DNA
EUR 167
Pacsin3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6370007 1.0 ug DNA
EUR 167
Pacsin3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6370008 1.0 ug DNA
EUR 167
Pacsin3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3491506 1.0 ug DNA
EUR 167
Pacsin3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3491507 1.0 ug DNA
EUR 167
Pacsin3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3491508 1.0 ug DNA
EUR 167
PACSIN3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1586906 1.0 ug DNA
EUR 167
PACSIN3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1586907 1.0 ug DNA
EUR 167
PACSIN3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1586908 1.0 ug DNA
EUR 167
Protein Kinase C And Casein Kinase Substrate In Neurons Protein 3 (PACSIN3) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protein Kinase C And Casein Kinase Substrate In Neurons Protein 3 (PACSIN3) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protein Kinase C And Casein Kinase Substrate In Neurons Protein 3 (PACSIN3) Antibody
abx145944-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Protein Kinase C And Casein Kinase Substrate In Neurons Protein 3 (PACSIN3) Antibody
abx033866-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Protein Kinase C And Casein Kinase Substrate In Neurons Protein 3 (PACSIN3) Antibody
abx033866-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Protein kinase C and casein kinase substrate in neurons protein 3 (PACSIN3) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Protein Kinase C And Casein Kinase Substrate In Neurons Protein 3 (PACSIN3) Antibody
abx236102-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Protein kinase C and casein kinase substrate in neurons protein 3 (PACSIN3) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Protein Kinase C And Casein Kinase Substrate In Neurons Protein 3 (PACSIN3) Antibody
abx432216-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Protein kinase C and casein kinase substrate in neurons protein 3 (PACSIN3) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Protein kinase C and casein kinase substrate in neurons protein 3 (PACSIN3) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Protein kinase C and casein kinase substrate in neurons protein 3 (PACSIN3) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Protein kinase C and casein kinase substrate in neurons protein 3 (PACSIN3) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Protein kinase C and casein kinase substrate in neurons protein 3 (PACSIN3) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Protein kinase C and casein kinase substrate in neurons protein 3 (PACSIN3) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human Protein kinase C and casein kinase substrate in neurons protein 3 (PACSIN3) ELISA Kit
abx382024-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
dCas9-KRAB Lentiviral Vector
K203 10 ug
EUR 228
Cas9 Nuclease Lentiviral Vector
K002 10 ug
EUR 154
Cas9 Nickase Lentiviral Vector
K005 10 ug
EUR 154
pSMPUW-MNDnLacZ Lentiviral Control Vector
LTV-402 10 µg
EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.
pLenti-GFP Lentiviral Control Vector
LTV-400 100 µL
EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.
pSMPUW-Puro Lentiviral Expression Vector
VPK-212 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.
pSMPUW-Neo Lentiviral Expression Vector
VPK-213 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.
pSMPUW-Hygro Lentiviral Expression Vector
VPK-214 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.
pLenti-RFP-Puro Lentiviral Control Vector
LTV-403 100 µL
EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.
pSMPUW-GFP-LC3 Lentiviral Expression Vector
LTV-801 10 µg
EUR 1204
Description: Expression vector contains a fusion of GFP and LC3. A separate GFP control vector is also included.
ESR1 Lentiviral Vector (Human) (pLenti-II)
LV010008 1.0 ug DNA
EUR 316
pSMPUW-GFP-Puro Lentiviral Control Vector
LTV-401 10 µg
EUR 618
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.
pSMPUW Universal Lentiviral Expression Vector (Promoterless)
VPK-211 10 µg
EUR 624
Description: Clone your gene of interest and a gene-specific promoter into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293T or 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.
pSMPUW-IRES-Puro Lentiviral Expression Vector
VPK-215 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.
pSMPUW-IRES-Neo Lentiviral Expression Vector
VPK-216 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.
pSMPUW-IRES-Hygro Lentiviral Expression Vector
VPK-217 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.
pSMPUW-IRES-Blasticidin Lentiviral Expression Vector
VPK-219 10 µg
EUR 624
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.
DPY19L1P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723333 1.0 ug DNA Ask for price
DPY19L1P2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV723334 1.0 ug DNA Ask for price
DRD5P1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV723353 1.0 ug DNA Ask for price
DRD5P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723357 1.0 ug DNA Ask for price
DRD5P1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV723358 1.0 ug DNA Ask for price
DRD5P2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV723359 1.0 ug DNA Ask for price
DRD5P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723363 1.0 ug DNA Ask for price
DRD5P2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV723364 1.0 ug DNA Ask for price
DSTNP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV723383 1.0 ug DNA Ask for price
DSTNP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723387 1.0 ug DNA Ask for price
DSTNP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV723388 1.0 ug DNA Ask for price
DSTNP3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV723389 1.0 ug DNA Ask for price
DSTNP3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723393 1.0 ug DNA Ask for price
DSTNP3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV723394 1.0 ug DNA Ask for price
DTX2P1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV723395 1.0 ug DNA Ask for price
DTX2P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723399 1.0 ug DNA Ask for price
DTX2P1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV723400 1.0 ug DNA Ask for price
DURS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV723401 1.0 ug DNA Ask for price
DURS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723405 1.0 ug DNA Ask for price
DURS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV723406 1.0 ug DNA Ask for price
DUSPP Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV723407 1.0 ug DNA Ask for price
DUSPP Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723411 1.0 ug DNA Ask for price
DUSPP Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV723412 1.0 ug DNA Ask for price
DUTP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV723413 1.0 ug DNA Ask for price
DUTP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723417 1.0 ug DNA Ask for price
DUTP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV723418 1.0 ug DNA Ask for price
DUTP2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV723419 1.0 ug DNA Ask for price
DUTP2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723423 1.0 ug DNA Ask for price
DUTP2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV723424 1.0 ug DNA Ask for price
DUTP4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV723425 1.0 ug DNA Ask for price

The affect of electrostatic interplay on the construction and the shear modulus of heat-set globular protein gels.

Gels fashioned by the globular protein β-lactoglobulin after warmth denaturation had been studied utilizing gentle scattering, turbidity and shear oscillation measurements. The construction of the gels was characterised when it comes to the amplitude and the correlation size of focus fluctuations. The energy of electrostatic interactions was diverse by altering the pH within the absence of added salt or by altering the NaCl focus at pH 7.
A really sturdy improve of the heterogeneity of the gels was noticed when lowering the pH in direction of the isoelectric level or when growing the salt focus. The structural change was interpreted when it comes to a lower of the online repulsion between the rising aggregates resulting in elevated focus fluctuations and at last microscopic part separation.
The elastic shear modulus elevated with lowering pH and confirmed a most as a perform of the NaCl focus. No direct correlation between the change within the construction and the elastic modulus was discovered.

Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) ELISA Kit

RD-CUZD1-Hu-48Tests 48 Tests
EUR 563

Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) ELISA Kit

RD-CUZD1-Hu-96Tests 96 Tests
EUR 783

Cuzd1/ Rat Cuzd1 ELISA Kit

ELI-06577r 96 Tests
EUR 886

CUZD1 ORF Vector (Human) (pORF)

ORF017858 1.0 ug DNA
EUR 405


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CUZD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV672163 1.0 ug DNA
EUR 682

CUZD1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV672167 1.0 ug DNA
EUR 682

CUZD1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV672168 1.0 ug DNA
EUR 682


ELI-06576h 96 Tests
EUR 824

Human CUZD1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CUZD1 Recombinant Protein (Human)

RP053571 100 ug Ask for price

Cuzd1 ORF Vector (Rat) (pORF)

ORF065616 1.0 ug DNA
EUR 506

Cuzd1 ORF Vector (Mouse) (pORF)

ORF042273 1.0 ug DNA
EUR 506

CUZD1 Protein Vector (Human) (pPB-C-His)

PV071429 500 ng
EUR 552

CUZD1 Protein Vector (Human) (pPB-N-His)

PV071430 500 ng
EUR 552

CUZD1 Protein Vector (Human) (pPM-C-HA)

PV071431 500 ng
EUR 552

CUZD1 Protein Vector (Human) (pPM-C-His)

PV071432 500 ng
EUR 552

CUZD1 ELISA Kit (Human) (OKAN06505)

OKAN06505 96 Wells
EUR 792
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059 ng/mL

CUZD1 ELISA Kit (Human) (OKCD02476)

OKCD02476 96 Wells
EUR 909
Description: Description of target: CUZD1 antiserum inhibits cell attachment and proliferation of ovarian cancer cells so may be involved in these processes. May also play a role in the uterus during late pregnancy and/or in trypsin activation in pancreatic acinar cells.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059 ng/mL

Mouse Cuzd1 ELISA KIT

ELI-06578m 96 Tests
EUR 865

Rat CUZD1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CUZD1 Recombinant Protein (Rat)

RP196844 100 ug Ask for price

CUZD1 Recombinant Protein (Mouse)

RP126815 100 ug Ask for price

CUZD1 sgRNA CRISPR Lentivector set (Human)

K0533601 3 x 1.0 ug
EUR 339

CUZD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV672164 1.0 ug DNA
EUR 682

CUZD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV672165 1.0 ug DNA
EUR 740

CUZD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV672166 1.0 ug DNA
EUR 740

CUZD1 Protein Vector (Mouse) (pPB-C-His)

PV169090 500 ng
EUR 603

CUZD1 Protein Vector (Mouse) (pPB-N-His)

PV169091 500 ng
EUR 603

CUZD1 Protein Vector (Mouse) (pPM-C-HA)

PV169092 500 ng
EUR 603

CUZD1 Protein Vector (Mouse) (pPM-C-His)

PV169093 500 ng
EUR 603

CUZD1 Protein Vector (Rat) (pPB-C-His)

PV262462 500 ng
EUR 603

CUZD1 Protein Vector (Rat) (pPB-N-His)

PV262463 500 ng
EUR 603

CUZD1 Protein Vector (Rat) (pPM-C-HA)

PV262464 500 ng
EUR 603

CUZD1 Protein Vector (Rat) (pPM-C-His)

PV262465 500 ng
EUR 603

CUZD1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0533602 1.0 ug DNA
EUR 154

CUZD1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0533603 1.0 ug DNA
EUR 154

CUZD1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0533604 1.0 ug DNA
EUR 154

CUZD1 ELISA Kit (Mouse) (OKCD09464)

OKCD09464 96 Wells
EUR 936
Description: Description of target: CUZD1 antiserum inhibits cell attachment and proliferation of ovarian cancer cells so may be involved in these processes. May also play a role in the uterus during late pregnancy and/or in trypsin activation in pancreatic acinar cells.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.068ng/mL

CUZD1 ELISA Kit (Rat) (OKCD09465)

OKCD09465 96 Wells
EUR 1157
Description: Description of target: protein specifically expressed in uterus and ovary and regulated by estrogen; may function in pregnancy.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.060ng/mL

Recombinant Human CUZD1 Protein, His, HEK 293-10ug

QP11570-10ug 10ug
EUR 201

Recombinant Human CUZD1 Protein, His, HEK 293-1mg

QP11570-1mg 1mg
EUR 5251

Recombinant Human CUZD1 Protein, His, HEK 293-2ug

QP11570-2ug 2ug
EUR 155

Cuzd1 sgRNA CRISPR Lentivector set (Rat)

K6973901 3 x 1.0 ug
EUR 339

Cuzd1 sgRNA CRISPR Lentivector set (Mouse)

K3691801 3 x 1.0 ug
EUR 339

Cuzd1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6973902 1.0 ug DNA
EUR 154

Cuzd1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6973903 1.0 ug DNA
EUR 154

Cuzd1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6973904 1.0 ug DNA
EUR 154

Cuzd1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3691802 1.0 ug DNA
EUR 154

Cuzd1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3691803 1.0 ug DNA
EUR 154

Cuzd1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3691804 1.0 ug DNA
EUR 154

Cuzd1 3'UTR GFP Stable Cell Line

TU154564 1.0 ml Ask for price

Cuzd1 3'UTR Luciferase Stable Cell Line

TU104564 1.0 ml Ask for price

Cuzd1 3'UTR Luciferase Stable Cell Line

TU202974 1.0 ml Ask for price

Cuzd1 3'UTR GFP Stable Cell Line

TU252974 1.0 ml Ask for price

CUZD1 3'UTR GFP Stable Cell Line

TU055290 1.0 ml
EUR 1394

CUZD1 3'UTR Luciferase Stable Cell Line

TU005290 1.0 ml
EUR 1394

CUZD1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0533605 3 x 1.0 ug
EUR 376

Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Protein

  • EUR 746.00
  • EUR 300.00
  • EUR 2346.00
  • EUR 899.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CUZD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0533606 1.0 ug DNA
EUR 167

CUZD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0533607 1.0 ug DNA
EUR 167

CUZD1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0533608 1.0 ug DNA
EUR 167

CUZD1 CUB And Zona Pellucida-Like Domains 1 Human Recombinant Protein

PROTQ86UP6 Regular: 10ug
EUR 317
Description: CUZD1 Human Recombinant produced in HEK cells is a single, glycosylated, polypeptide chain (Glu25-Ser568) containing a total of 554 amino acids, having a calculated molecular mass of 62.2kDa and fused to a 10 aa His tag at C-Terminus.

Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Monoclonal Antibody (Human)

  • EUR 270.00
  • EUR 2879.00
  • EUR 709.00
  • EUR 343.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1)

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Polyclonal Antibody (Human)

  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CUZD1 (Pro218~Arg479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1)

Human CUB And Zona Pellucida Like Domains Protein 1(CUZD1)ELISA Kit

QY-E05019 96T
EUR 361

Human CUB And Zona Pellucida Like Domains Protein 1 ELISA Kit (CUZD1)

RK01220 96 Tests
EUR 521

Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) ELISA Kit

SEQ635Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) ELISA Kit

SEQ635Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) ELISA Kit

SEQ635Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) ELISA Kit

SEQ635Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as CUB And Zona Pellucida Like Domains Protein 1 elisa. Alternative names of the recognized antigen: ERG-1
  • UO-44
  • Transmembrane protein UO-44
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Antibody

  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Antibody

  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Antibody

  • EUR 356.00
  • EUR 926.00
  • EUR 467.00
  • EUR 154.00
  • EUR 272.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cuzd1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6973905 3 x 1.0 ug
EUR 376

Cuzd1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3691805 3 x 1.0 ug
EUR 376

Recombinant CUB And Zona Pellucida Like Domains Protein 1 (CUZD1)

  • EUR 539.04
  • EUR 247.00
  • EUR 1746.40
  • EUR 648.80
  • EUR 1197.60
  • EUR 424.00
  • EUR 4216.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q86UP6
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 59.0kDa
  • Isoelectric Point: 6
Description: Recombinant Human CUB And Zona Pellucida Like Domains Protein 1 expressed in: E.coli

Recombinant CUB And Zona Pellucida Like Domains Protein 1 (CUZD1)

  • EUR 544.42
  • EUR 248.00
  • EUR 1766.56
  • EUR 655.52
  • EUR 1211.04
  • EUR 427.00
  • EUR 4266.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P70412
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 56.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse CUB And Zona Pellucida Like Domains Protein 1 expressed in: E.coli

Recombinant CUB And Zona Pellucida Like Domains Protein 1 (CUZD1)

  • EUR 556.96
  • EUR 252.00
  • EUR 1813.60
  • EUR 671.20
  • EUR 1242.40
  • EUR 436.00
  • EUR 4384.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9QZT0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 56.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat CUB And Zona Pellucida Like Domains Protein 1 expressed in: E.coli

Human CUZD1/ CUB and zona pellucida-like domain-containing protein 1 ELISA Kit

E0610Hu 1 Kit
EUR 571

Human CUB and zona pellucida like domain containing protein 1(CUZD1) ELISA kit

E01C2190-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CUB and zona pellucida like domain containing protein 1(CUZD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CUB and zona pellucida like domain containing protein 1(CUZD1) ELISA kit

E01C2190-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CUB and zona pellucida like domain containing protein 1(CUZD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CUB and zona pellucida like domain containing protein 1(CUZD1) ELISA kit

E01C2190-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CUB and zona pellucida like domain containing protein 1(CUZD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CUB and zona pellucida-like domain-containing protein 1 (CUZD1) ELISA Kit

abx572687-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human CUZD1 (CUB And Zona Pellucida Like Domains Protein 1)

ELK6563 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to CUB And Zona Pellucida Like Domains Protein 1 (CUZD1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated a
  • Show more
Description: A sandwich ELISA kit for detection of CUB And Zona Pellucida Like Domains Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Monoclonal Antibody (Human), APC

  • EUR 380.00
  • EUR 3779.00
  • EUR 1038.00
  • EUR 490.00
  • EUR 234.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1). This antibody is labeled with APC.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Monoclonal Antibody (Human), Biotinylated

  • EUR 337.00
  • EUR 2829.00
  • EUR 819.00
  • EUR 417.00
  • EUR 230.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1). This antibody is labeled with Biotin.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Monoclonal Antibody (Human), Cy3

  • EUR 465.00
  • EUR 4997.00
  • EUR 1343.00
  • EUR 612.00
  • EUR 271.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1). This antibody is labeled with Cy3.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Monoclonal Antibody (Human), FITC

  • EUR 324.00
  • EUR 3043.00
  • EUR 850.00
  • EUR 412.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1). This antibody is labeled with FITC.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Monoclonal Antibody (Human), HRP

  • EUR 346.00
  • EUR 3291.00
  • EUR 916.00
  • EUR 441.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1). This antibody is labeled with HRP.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Monoclonal Antibody (Human), PE

  • EUR 324.00
  • EUR 3043.00
  • EUR 850.00
  • EUR 412.00
  • EUR 207.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1). This antibody is labeled with PE.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Polyclonal Antibody (Human), APC

  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CUZD1 (Pro218~Arg479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1). This antibody is labeled with APC.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Polyclonal Antibody (Human), Biotinylated

  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CUZD1 (Pro218~Arg479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1). This antibody is labeled with Biotin.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Polyclonal Antibody (Human), Cy3

  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CUZD1 (Pro218~Arg479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1). This antibody is labeled with Cy3.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Polyclonal Antibody (Human), FITC

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CUZD1 (Pro218~Arg479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1). This antibody is labeled with FITC.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Polyclonal Antibody (Human), HRP

  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CUZD1 (Pro218~Arg479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1). This antibody is labeled with HRP.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Polyclonal Antibody (Human), PE

  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CUZD1 (Pro218~Arg479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1). This antibody is labeled with PE.

CUB And Zona Pellucida-Like Domain-Containing Protein 1 (CUZD1) Antibody

abx026112-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

CUB And Zona Pellucida-Like Domain-Containing Protein 1 (CUZD1) Antibody

abx026112-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mouse CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Protein

  • EUR 759.00
  • EUR 300.00
  • EUR 2374.00
  • EUR 899.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Protein

  • EUR 773.00
  • EUR 300.00
  • EUR 2444.00
  • EUR 926.00
  • EUR 551.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Antibody (FITC)

  • EUR 509.00
  • EUR 258.00
  • EUR 1539.00
  • EUR 718.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Antibody (FITC)

  • EUR 523.00
  • EUR 258.00
  • EUR 1581.00
  • EUR 732.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Antibody (Biotin)

  • EUR 481.00
  • EUR 244.00
  • EUR 1428.00
  • EUR 676.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Antibody (Biotin)

  • EUR 495.00
  • EUR 258.00
  • EUR 1469.00
  • EUR 690.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Antibody Pair

  • EUR 1957.00
  • EUR 1233.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Antibody Pair

  • EUR 1901.00
  • EUR 1205.00
  • 10 × 96 tests
  • 5 × 96 tests
  • Shipped within 5-15 working days.

Cuzd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6973906 1.0 ug DNA
EUR 167

Cuzd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6973907 1.0 ug DNA
EUR 167

Cuzd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6973908 1.0 ug DNA
EUR 167

Cuzd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3691806 1.0 ug DNA
EUR 167

Cuzd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3691807 1.0 ug DNA
EUR 167

Cuzd1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3691808 1.0 ug DNA
EUR 167

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Monoclonal Antibody (Human), APC-Cy7

  • EUR 641.00
  • EUR 7438.00
  • EUR 1957.00
  • EUR 860.00
  • EUR 349.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1). This antibody is labeled with APC-Cy7.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Polyclonal Antibody (Human), APC-Cy7

  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CUZD1 (Pro218~Arg479)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human CUB And Zona Pellucida Like Domains Protein 1 (CUZD1). This antibody is labeled with APC-Cy7.

Mouse CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) ELISA Kit

  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) ELISA Kit

  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Polyclonal Antibody (Mouse)

  • EUR 266.00
  • EUR 2813.00
  • EUR 694.00
  • EUR 337.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CUZD1 (Ala291~Ala545)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse CUB And Zona Pellucida Like Domains Protein 1 (CUZD1)

CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) Polyclonal Antibody (Rat)

  • EUR 275.00
  • EUR 2958.00
  • EUR 727.00
  • EUR 350.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CUZD1 (Gly257~Val517)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat CUB And Zona Pellucida Like Domains Protein 1 (CUZD1)

Mouse CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) ELISA Kit

SEQ635Mu-10x96wellstestplate 10x96-wells test plate
EUR 5333.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse CUB And Zona Pellucida Like Domains Protein 1 (CUZD1) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Leave a Reply

Your email address will not be published. Required fields are marked *