December 3, 2020

Viral Vectors for Translational Analysis

etwhittaker

Gene-Enhancing Applied sciences Paired With Viral Vectors for Translational Analysis Into Neurodegenerative Illnesses

Illnesses of the central nervous system (CNS) have traditionally been among the many most tough to deal with utilizing standard pharmacological approaches. This is because of a confluence of things, together with the restricted regenerative capability and total complexity of the mind, issues related to repeated drug administration, and difficulties delivering medicine throughout the blood-brain barrier (BBB).

Viral-mediated gene switch represents a lovely various for the supply of therapeutic cargo to the nervous system. Crucially, it often requires solely a single injection, whether or not that be a gene alternative technique for an inherited dysfunction or the supply of a genome- or epigenome-modifying assemble for therapy of CNS ailments and problems.

It’s thus comprehensible that appreciable effort has been put in the direction of the event of improved vector techniques for gene switch into the CNS. Totally different viral vectors are in fact tailor-made to their particular purposes, however they typically ought to share a number of key properties.

The best viral vector incorporates a high-packaging capability, environment friendly gene switch paired with sturdy and sustained expression, lack of oncogenicity, toxicity and pathogenicity, and scalable manufacturing for scientific purposes. On this assessment, we are going to dedicate consideration to viral vectors derived from human immunodeficiency virus sort 1 (lentiviral vectors; LVs) and adeno-associated virus (AAVs). The excessive curiosity in these viral supply techniques vectors is because of:

 (i) sturdy supply and long-lasting expression; 

(ii) environment friendly transduction into postmitotic cells, together with the mind; 

(iii) low immunogenicity and toxicity; and 

(iv) compatibility with superior manufacturing methods.

Right here, we are going to define primary elements of LV and AAV biology, significantly specializing in approaches and methods aiming to boost viral security. 

We may also allocate a good portion of this assessment to the event and use of LVs and AAVs for supply into the CNS, with a give attention to the genome and epigenome-editing instruments based mostly on clustered often interspaced quick palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas 9) and the event of novel methods for the therapy of neurodegenerative ailments (NDDs).  

An environment friendly virus-induced gene silencing (VIGS) system for useful genomics in Brassicas utilizing a cabbage leaf curl virus (CaLCuV)-based vector

CaLCuV-based VIGS successfully works in cabbage and contributes to environment friendly useful genomics analysis in Brassica crop species.

Virus-induced gene silencing (VIGS), a posttranscriptional gene silencing methodology, is an efficient method for analysing the features of genes in vegetation.

Nonetheless, no VIGS vectors have been obtainable for Brassica oleracea till now. Right here, tobacco rattle virus (TRV), pTYs and cabbage leaf curl virus (CaLCuV) gene-silencing vectors (PCVA/PCVB) have been chosen to enhance the VIGS system in cabbage utilizing the phytoene desaturase (PDS) gene as an environment friendly visible indicator of VIGS. We efficiently silenced the expression of PDS and noticed photobleaching phenomena in cabbage in response to pTYs and CaLCuV, with the latter being easier to function and cheaper. 

The parameters probably affecting the silencing effectivity of VIGS by CaLCuV in cabbage, together with the concentrating on fragment technique, inoculation methodology and incubation temperature, have been then in contrast. The optimized CaLCuV-based VIGS system includes the next: an roughly 500 bp insert sequence, an Agrobacterium OD600 of 1.0, use of the vacuum osmosis methodology utilized on the bud stage, and an incubation temperature of 22 °C. Utilizing these parameters, we achieved a secure silencing effectivity of 65%.

To additional take a look at the effectiveness of the system, we chosen the Mg-chelatase H subunit (ChlH) gene in cabbage and knocked down its expression, and we noticed yellow leaves, as anticipated. We efficiently utilized the CaLCuV-based VIGS system to 2 different consultant Brassica crop species, B. rapa and B. nigra, and thus expanded the applying scope of this technique. Our VIGS system described right here will contribute to environment friendly useful genomics analysis in Brassica crop species.

etwhittaker
etwhittaker

ADIPOQ antibody

38421-100ul 100ul
EUR 252.00

ADIPOQ Antibody

31141-100ul 100ul
EUR 252.00

ADIPOQ Antibody

31141-50ul 50ul
EUR 187.00

ADIPOQ Antibody

DF7000 200ul
EUR 304.00
Description: ADIPOQ Antibody detects endogenous levels of total ADIPOQ.

ADIPOQ Antibody

1-CSB-PA938581
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

ADIPOQ Antibody

1-CSB-PA000014
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

ADIPOQ Antibody

1-CSB-PA000806
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

ADIPOQ Antibody

CSB-PA828343-
EUR 335.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

ADIPOQ Antibody

CSB-PA828343-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

ADIPOQ Antibody

1-CSB-PA618019YA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

ADIPOQ Antibody

1-CSB-PA661101LA01BO
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from bovine. This antibody is Unconjugated. Tested in the following application: ELISA

ADIPOQ Antibody

1-CSB-PA661101YA01BO
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Bovine. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

ADIPOQ Antibody

1-CSB-PA293186
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

ADIPOQ Antibody

1-CSB-PA149289
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

Adipoq Antibody

1-CSB-PA07946A0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Adipoq. Recognizes Adipoq from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

ADIPOQ Antibody

1-CSB-PA07956A0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

ADIPOQ Antibody

1-CSB-PA07957A0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ADIPOQ antibody

PAab09814 100 ug
EUR 386.00

ADIPOQ Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV700825 1.0 ug DNA
EUR 514.00

ADIPOQ Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV700829 1.0 ug DNA
EUR 514.00

ADIPOQ Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV700830 1.0 ug DNA
EUR 514.00

Adipoq ORF Vector (Mouse) (pORF)

ORF038176 1.0 ug DNA
EUR 95.00

ADIPOQ ORF Vector (Human) (pORF)

ORF012163 1.0 ug DNA
EUR 354.00

Adipoq ORF Vector (Rat) (pORF)

ORF063117 1.0 ug DNA
EUR 506.00

ADIPOQ-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV718301 1.0 ug DNA Ask for price

ADIPOQ-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV718305 1.0 ug DNA Ask for price

ADIPOQ-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV718306 1.0 ug DNA Ask for price

ADIPOQ Conjugated Antibody

C38421 100ul
EUR 397.00

ADIPOQ Conjugated Antibody

C31141 100ul
EUR 397.00

ADIPOQ cloning plasmid

CSB-CL618019HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 735
  • Sequence: ATGCTGTTGCTGGGAGCTGTTCTACTGCTATTAGCTCTGCCCGGTCATGACCAGGAAACCACGACTCAAGGGCCCGGAGTCCTGCTTCCCCTGCCCAAGGGGGCCTGCACAGGTTGGATGGCGGGCATCCCAGGGCATCCGGGCCATAATGGGGCCCCAGGCCGTGATGGCAGAGA
  • Show more
Description: A cloning plasmid for the ADIPOQ gene.

anti- ADIPOQ antibody

FNab00170 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: adiponectin, C1Q and collagen domain containing
  • Uniprot ID: Q15848
  • Gene ID: 9370
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against ADIPOQ

anti- ADIPOQ antibody

FNab09814 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: ADIPOQ
  • Uniprot ID: Q15848
  • Gene ID: 9370
Description: Antibody raised against ADIPOQ

Adiponectin (ADIPOQ) Antibody

20-abx001981
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Adiponectin (ADIPOQ) Antibody

20-abx141288
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Adiponectin (ADIPOQ) Antibody

abx147913-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

Adiponectin (ADIPOQ) Antibody

abx224369-100ug 100 ug
EUR 411.00
  • Shipped within 5-10 working days.

Adiponectin (ADIPOQ) Antibody

abx239837-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Adiponectin (ADIPOQ) Antibody

abx224470-100ug 100 ug
EUR 411.00
  • Shipped within 5-10 working days.

Adiponectin (ADIPOQ) Antibody

abx230170-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Adipoq Polyclonal Antibody

A56646 100 µg
EUR 570.55
Description: kits suitable for this type of research

ADIPOQ Polyclonal Antibody

A53605 100 µg
EUR 570.55
Description: Ask the seller for details

ADIPOQ Polyclonal Antibody

A54069 100 µg
EUR 570.55
Description: kits suitable for this type of research

ADIPOQ Polyclonal Antibody

A54866 100 µg
EUR 570.55
Description: Ask the seller for details

ADIPOQ Polyclonal Antibody

A55046 100 µg
EUR 570.55
Description: The best epigenetics products

ADIPOQ Polyclonal Antibody

A55747 100 µg
EUR 570.55
Description: The best epigenetics products

ADIPOQ Rabbit pAb

A2543-100ul 100 ul
EUR 308.00

ADIPOQ Rabbit pAb

A2543-200ul 200 ul
EUR 459.00

ADIPOQ Rabbit pAb

A2543-20ul 20 ul
EUR 183.00

ADIPOQ Rabbit pAb

A2543-50ul 50 ul
EUR 223.00

ADIPOQ Blocking Peptide

DF7000-BP 1mg
EUR 195.00

Bovine Adiponectin (ADIPOQ)

1-CSB-YP661101BO
  • EUR 679.00
  • EUR 335.00
  • EUR 2172.00
  • EUR 1051.00
  • EUR 1442.00
  • EUR 435.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 26.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Bovine Adiponectin(ADIPOQ) expressed in Yeast

Mouse Adiponectin (Adipoq)

1-CSB-RP079474m
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 20.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Adiponectin(Adipoq),partial expressed in E.coli

Bovine Adiponectin (ADIPOQ)

1-CSB-EP661101BO
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 40.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Bovine Adiponectin(ADIPOQ) expressed in E.coli

Mouse Adiponectin (Adipoq)

1-CSB-EP723362MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 28.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Adiponectin(Adipoq) expressed in E.coli

anti- ADIPOQ antibody

LSMab09814 100 ug
EUR 386.00

Anti-ADIPOQ antibody

STJ400002 1 mg
EUR 446.00
Description: Adiponectin is a protein hormone that modulates a number of metabolic processes that may lead to type 2 diabetes, obesity and atherosclerosis. It has been studied as a prognostic and diagnostic marker of diabetes and cardiovascular diseases.

Anti-ADIPOQ antibody

STJ400003 1 mg
EUR 446.00
Description: Adiponectin is a protein hormone that modulates a number of metabolic processes that may lead to type 2 diabetes, obesity and atherosclerosis. It has been studied as a prognostic and diagnostic marker of diabetes and cardiovascular diseases.

Anti-ADIPOQ antibody

STJ400004 1 mg
EUR 446.00
Description: Adiponectin is a protein hormone that modulates a number of metabolic processes that may lead to type 2 diabetes, obesity and atherosclerosis. It has been studied as a prognostic and diagnostic marker of diabetes and cardiovascular diseases.

Anti-ADIPOQ antibody

STJ22521 100 µl
EUR 277.00
Description: This gene is expressed in adipose tissue exclusively. It encodes a protein with similarity to collagens X and VIII and complement factor C1q. The encoded protein circulates in the plasma and is involved with metabolic and hormonal processes. Mutations in this gene are associated with adiponectin deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified.

ADIPOQ-AS1 ORF Vector (Human) (pORF)

ORF015332 1.0 ug DNA Ask for price

Human ADIPOQ ELISA Kit

ELA-E0605h 96 Tests
EUR 824.00

Human ADIPOQ shRNA Plasmid

20-abx956206
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

ADIPOQ protein (His tag)

80R-3774 100 ug
EUR 327.00
Description: Purified recombinant ADIPOQ protein (His tag)

Mouse ADIPOQ shRNA Plasmid

20-abx969009
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human ADIPOQ ELISA Kit

DEIA215 96T
EUR 850.00
Description: This assay is a sandwich Enzyme Linked-Immuno-Sorbent Assay (ELISA). It is developed for quantitative measurement of Human ADIPOQ in serum, plasma and other biological fluids.

ADIPOQ Antibody, HRP conjugated

1-CSB-PA618019YB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADIPOQ Antibody, FITC conjugated

1-CSB-PA618019YC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADIPOQ Antibody, Biotin conjugated

1-CSB-PA618019YD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ADIPOQ Antibody, HRP conjugated

1-CSB-PA661101LB01BO
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from bovine. This antibody is HRP conjugated. Tested in the following application: ELISA

ADIPOQ Antibody, FITC conjugated

1-CSB-PA661101LC01BO
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from bovine. This antibody is FITC conjugated. Tested in the following application: ELISA

ADIPOQ Antibody, Biotin conjugated

1-CSB-PA661101LD01BO
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from bovine. This antibody is Biotin conjugated. Tested in the following application: ELISA

ADIPOQ Antibody, HRP conjugated

1-CSB-PA661101YB01BO
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Bovine. This antibody is HRP conjugated. Tested in the following application: ELISA

ADIPOQ Antibody, FITC conjugated

1-CSB-PA661101YC01BO
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Bovine. This antibody is FITC conjugated. Tested in the following application: ELISA

ADIPOQ Antibody, Biotin conjugated

1-CSB-PA661101YD01BO
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Bovine. This antibody is Biotin conjugated. Tested in the following application: ELISA

Adipoq Antibody, HRP conjugated

1-CSB-PA07946B0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Adipoq. Recognizes Adipoq from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Adipoq Antibody, FITC conjugated

1-CSB-PA07946C0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Adipoq. Recognizes Adipoq from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Adipoq Antibody, Biotin conjugated

1-CSB-PA07946D0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Adipoq. Recognizes Adipoq from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

ADIPOQ Antibody, HRP conjugated

1-CSB-PA07956B0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADIPOQ Antibody, FITC conjugated

1-CSB-PA07956C0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADIPOQ Antibody, Biotin conjugated

1-CSB-PA07956D0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ADIPOQ Antibody, HRP conjugated

1-CSB-PA07957B0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADIPOQ Antibody, FITC conjugated

1-CSB-PA07957C0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADIPOQ Antibody, Biotin conjugated

1-CSB-PA07957D0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADIPOQ. Recognizes ADIPOQ from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Adiponectin/ADIPOQ Antibody

PB9001 100ug/vial
EUR 334.00

Anti-Adiponectin/ADIPOQ Antibody

PB9011 100ug/vial
EUR 334.00

Anti-Adiponectin/ADIPOQ Antibody

PA2014 100ug/vial
EUR 334.00

Anti-Adiponectin/ADIPOQ Antibody

PA2014-1 100ug/vial
EUR 334.00

Human ADIPOQ ELISA Kit

STJ150096 1 kit
EUR 412.00
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of ADP/Acrp30 in human serum, plasma and other biological fluids

Rat ADIPOQ ELISA Kit

STJ150185 1 kit
EUR 412.00
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of ADP/Acrp30 in Rat serum, plasma and other biological fluids

Ocular Gene Remedy with Adeno-associated Virus Vectors: Present Outlook for Sufferers and Researchers

On this “Perspective”, we talk about ocular gene remedy – the affected person’s perspective, the assorted methods of gene alternative and gene enhancing, the place of adeno-associated virus vectors, routes of supply to the attention and the remaining query – “why does immunity proceed to restrict efficacy?” By way of the coordinated efforts of sufferers, researchers, granting businesses and trade, and after a few years of pre-clinical research, biochemical, mobile, and animal fashions, we’re seeing scientific trials emerge for a lot of beforehand untreatable heritable ocular problems. 

The pathway to therapies has been led by the profitable therapy of the RPE65 type of Leber congenital amaurosis with LUXTURNA TM . In some instances, immune reactions to the vectors proceed to happen, limiting efficacy. The underlying mechanisms of irritation require additional research, and new vectors have to be designed that restrict the triggers of immunity. Researchers learning ocular gene therapies and clinicians enrolling sufferers in scientific trials should acknowledge the present limitations of those therapies to correctly handle expectations and keep away from disappointment, however we consider that gene therapies are nicely on their option to profitable, widespread utilization to deal with heritable ocular problems. 

VSIG10 Antibody

40293-100ul 100ul
EUR 252.00

VSIG10 Antibody

1-CSB-PA174683
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VSIG10. Recognizes VSIG10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

VSIG10 Antibody

1-CSB-PA122476
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against VSIG10. Recognizes VSIG10 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

VSIG10 Conjugated Antibody

C40293 100ul
EUR 397.00

VSIG10 ORF Vector (Human) (pORF)

ORF035824 1.0 ug DNA Ask for price

Vsig10 ORF Vector (Mouse) (pORF)

ORF061669 1.0 ug DNA
EUR 506.00

Mouse Vsig10 ELISA KIT

ELI-40231m 96 Tests
EUR 865.00

Human VSIG10 ELISA KIT

ELI-40588h 96 Tests
EUR 824.00

Human VSIG10 shRNA Plasmid

20-abx960156
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse VSIG10 shRNA Plasmid

20-abx981899
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

VSIG10 Recombinant Protein (Human)

RP107468 100 ug Ask for price

VSIG10 Recombinant Protein (Mouse)

RP185003 100 ug Ask for price

VSIG10 Protein Vector (Human) (pPB-C-His)

PV143294 500 ng Ask for price

VSIG10 Protein Vector (Human) (pPB-N-His)

PV143295 500 ng Ask for price

VSIG10 Protein Vector (Human) (pPM-C-HA)

PV143296 500 ng Ask for price

VSIG10 Protein Vector (Human) (pPM-C-His)

PV143297 500 ng Ask for price

VSIG10 Protein Vector (Mouse) (pPB-C-His)

PV246674 500 ng
EUR 603.00

VSIG10 Protein Vector (Mouse) (pPB-N-His)

PV246675 500 ng
EUR 603.00

VSIG10 Protein Vector (Mouse) (pPM-C-HA)

PV246676 500 ng
EUR 603.00

VSIG10 Protein Vector (Mouse) (pPM-C-His)

PV246677 500 ng
EUR 603.00

VSIG10 sgRNA CRISPR Lentivector set (Human)

K2817501 3 x 1.0 ug
EUR 339.00

Vsig10 sgRNA CRISPR Lentivector set (Mouse)

K5013001 3 x 1.0 ug
EUR 339.00

VSIG10 sgRNA CRISPR Lentivector (Human) (Target 1)

K2817502 1.0 ug DNA
EUR 154.00

VSIG10 sgRNA CRISPR Lentivector (Human) (Target 2)

K2817503 1.0 ug DNA
EUR 154.00

VSIG10 sgRNA CRISPR Lentivector (Human) (Target 3)

K2817504 1.0 ug DNA
EUR 154.00

Vsig10 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5013002 1.0 ug DNA
EUR 154.00

Vsig10 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5013003 1.0 ug DNA
EUR 154.00

Vsig10 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5013004 1.0 ug DNA
EUR 154.00

Vsig10 3'UTR GFP Stable Cell Line

TU172151 1.0 ml Ask for price

VSIG10 3'UTR GFP Stable Cell Line

TU078318 1.0 ml
EUR 2333.00

Vsig10 3'UTR Luciferase Stable Cell Line

TU122151 1.0 ml Ask for price

VSIG10 3'UTR Luciferase Stable Cell Line

TU028318 1.0 ml
EUR 2333.00

VSIG10 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2817505 3 x 1.0 ug
EUR 376.00

Vsig10 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K5013005 3 x 1.0 ug
EUR 376.00

VSIG10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2817506 1.0 ug DNA
EUR 167.00

VSIG10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2817507 1.0 ug DNA
EUR 167.00

VSIG10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2817508 1.0 ug DNA
EUR 167.00

Vsig10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K5013006 1.0 ug DNA
EUR 167.00

Vsig10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K5013007 1.0 ug DNA
EUR 167.00

Vsig10 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K5013008 1.0 ug DNA
EUR 167.00

Cas9 Nuclease Lentiviral Vector

K002 10 ug
EUR 154.00

Cas9 Nickase Lentiviral Vector

K005 10 ug
EUR 154.00

dCas9-KRAB Lentiviral Vector

K203 10 ug
EUR 228.00

pLenti-GFP Lentiviral Control Vector

LTV-400 100 µL
EUR 618.00
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW-MNDnLacZ Lentiviral Control Vector

LTV-402 10 µg
EUR 618.00
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW-Puro Lentiviral Expression Vector

VPK-212 10 µg
EUR 624.00
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-Neo Lentiviral Expression Vector

VPK-213 10 µg
EUR 624.00
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-Hygro Lentiviral Expression Vector

VPK-214 10 µg
EUR 624.00
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-GFP-Puro Lentiviral Control Vector

LTV-401 10 µg
EUR 618.00
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pLenti-RFP-Puro Lentiviral Control Vector

LTV-403 100 µL
EUR 618.00
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW-GFP-LC3 Lentiviral Expression Vector

LTV-801 10 µg
EUR 1204.00
Description: Expression vector contains a fusion of GFP and LC3. A separate GFP control vector is also included.

ESR1 Lentiviral Vector (Human) (pLenti-II)

LV010008 1.0 ug DNA
EUR 316.00

pSMPUW Universal Lentiviral Expression Vector (Promoterless)

VPK-211 10 µg
EUR 624.00
Description: Clone your gene of interest and a gene-specific promoter into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293T or 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Puro Lentiviral Expression Vector

VPK-215 10 µg
EUR 624.00
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Neo Lentiviral Expression Vector

VPK-216 10 µg
EUR 624.00
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Hygro Lentiviral Expression Vector

VPK-217 10 µg
EUR 624.00
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Blasticidin Lentiviral Expression Vector

VPK-219 10 µg
EUR 624.00
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

PLEKHG5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662599 1.0 ug DNA
EUR 1355.00

PLEKHG5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV662603 1.0 ug DNA
EUR 1355.00

PLEKHG5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV662604 1.0 ug DNA
EUR 1355.00

ZBTB44 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662605 1.0 ug DNA
EUR 682.00

ZBTB44 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV662609 1.0 ug DNA
EUR 682.00

ZBTB44 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV662610 1.0 ug DNA
EUR 682.00

GAS8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662611 1.0 ug DNA
EUR 682.00

GAS8 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV662615 1.0 ug DNA
EUR 682.00

GAS8 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV662616 1.0 ug DNA
EUR 682.00

Aldh1a7 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662617 1.0 ug DNA
EUR 682.00

Aldh1a7 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV662621 1.0 ug DNA
EUR 682.00

Aldh1a7 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV662622 1.0 ug DNA
EUR 682.00

PAN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662623 1.0 ug DNA
EUR 1355.00

PAN2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV662627 1.0 ug DNA
EUR 1355.00

PAN2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV662628 1.0 ug DNA
EUR 1355.00

GIPC2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662629 1.0 ug DNA
EUR 514.00

GIPC2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV662633 1.0 ug DNA
EUR 514.00

GIPC2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV662634 1.0 ug DNA
EUR 514.00

SULT4A1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662635 1.0 ug DNA
EUR 514.00

SULT4A1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV662639 1.0 ug DNA
EUR 514.00

SULT4A1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV662640 1.0 ug DNA
EUR 514.00

WDR5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662641 1.0 ug DNA
EUR 682.00

WDR5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV662645 1.0 ug DNA
EUR 682.00

WDR5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV662646 1.0 ug DNA
EUR 682.00

CENPN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662647 1.0 ug DNA
EUR 682.00

CENPN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV662651 1.0 ug DNA
EUR 682.00

CENPN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV662652 1.0 ug DNA
EUR 682.00

MKNK2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662653 1.0 ug DNA
EUR 682.00

MKNK2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV662657 1.0 ug DNA
EUR 682.00

MKNK2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV662658 1.0 ug DNA
EUR 682.00

COPS8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662659 1.0 ug DNA
EUR 514.00

COPS8 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV662663 1.0 ug DNA
EUR 514.00

COPS8 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV662664 1.0 ug DNA
EUR 514.00

Ril Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662665 1.0 ug DNA
EUR 514.00

Ril Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV662669 1.0 ug DNA
EUR 514.00

Ril Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV662670 1.0 ug DNA
EUR 514.00

KPNB1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662671 1.0 ug DNA
EUR 1355.00

KPNB1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV662675 1.0 ug DNA
EUR 1355.00

KPNB1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV662676 1.0 ug DNA
EUR 1355.00

RABEP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662677 1.0 ug DNA
EUR 1355.00

RABEP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV662681 1.0 ug DNA
EUR 1355.00

RABEP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV662682 1.0 ug DNA
EUR 1355.00

PSMC5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662683 1.0 ug DNA
EUR 682.00

PSMC5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV662687 1.0 ug DNA
EUR 682.00

PSMC5 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV662688 1.0 ug DNA
EUR 682.00

SHOX2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV662689 1.0 ug DNA
EUR 514.00