December 3, 2020
etwhittaker

Antibody Dependent Enhancement and Sendai Virus as a Attainable Vaccine Vector

The Challenges of Vaccine Growth in opposition to Betacoronaviruses: Antibody Dependent Enhancement and Sendai Virus as a Attainable Vaccine Vector

To design an efficient and protected vaccine in opposition to betacoronaviruses, it’s crucial to make use of their evolutionarily conservative antigenic determinants that may elicit the mix of robust humoral and cell-mediated immune responses. Focusing on such determinants minimizes the chance of antibody-dependent enhancement of viral an infection. This phenomenon was noticed in animal trials of experimental vaccines in opposition to SARS-CoV-1 and MERS-CoV that have been developed based mostly on inactivated coronavirus or vector constructs expressing the spike protein (S) of the virion. The substitution and glycosylation of sure amino acids within the antigenic determinants of the S-protein, in addition to its conformational adjustments, can result in the identical impact in a brand new experimental vaccine in opposition to SARS-CoV-2. Utilizing extra conservative structural and accent viral proteins for the vaccine antigenic determinants will assist to keep away from this drawback. This evaluation outlines approaches for creating vaccines in opposition to the brand new SARS-CoV-2 coronavirus which might be based mostly on non-pathogenic viral vectors. For environment friendly prevention of infections attributable to respiratory pathogens the flexibility of the vaccine to stimulate mucosal immunity within the respiratory tract is essential. Such a vaccine might be developed utilizing non-pathogenic Sendai virus vector, since it may be administered intranasally and induce a mucosal immune response that strengthens the antiviral barrier within the respiratory tract and offers dependable safety in opposition to an infection.

Growth of Excessive Decision DNA Melting Evaluation for Simultaneous Detection of Potato Mop-High Virus and Its Vector, Spongospora subterranea, in Soil

On this examine, a set of duplex reverse transcription (RT)-PCR-mediated excessive decision DNA melting (HRM) analyses for simultaneous detection of potato mop-virus (PMTV) and its protist vector, Spongospora subterranea f.sp. subterranea (Sss), was developed. The infestation of soil by PMTV was detected through the use of a tobacco-based baiting system. Complete RNA extracted from the soil led to profitable RT-PCR gel-electrophoresis detection of each PMTV and Sss. To facilitate extra environment friendly detection, newly designed primer pairs for PMTV RNA species (i.e., RNA-Rep, -CP, and -TGB) have been analyzed along with the present Sss primers utilizing real-time RT-PCR. The ensuing amplicons exhibited melting profiles that might be readily differentiated. Below duplex RT-PCR format, all PMTV and Sss primer mixtures led to profitable detection of respective PMTV RNA species and Sss within the samples by excessive decision DNA melting (HRM) analyses. When the duplex HRM assay was utilized to soil samples collected from six fields at 4 completely different websites in New Brunswick, Canada, optimistic detection of PMTV and/or Sss was present in 63-100% samples collected from fields through which PMTV-infected tubers had been noticed. In distinction, the samples from fields the place neither PMTV- nor Sss-infected tubers had been noticed resulted in damaging detection by the assay. Bait tobacco bioassay for PMTV and Sss produced related outcomes. Between 63%-83% and 100% of the soil samples collected from PMTV-infested fields led to PMTV and Sss infections within the bait tobacco crops, respectively; whereas no PMTV or Sss contaminated crops have been obtained from soil samples collected from PMTV/Sss-free fields.
etwhittaker
etwhittaker

pSMPUW-MNDnLacZ Lentiviral Control Vector

LTV-402 10 µg
EUR 618.00
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pLenti-GFP Lentiviral Control Vector

LTV-400 100 µL
EUR 618.00
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW-Puro Lentiviral Expression Vector

VPK-212 10 µg
EUR 624.00
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-Neo Lentiviral Expression Vector

VPK-213 10 µg
EUR 624.00
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-Hygro Lentiviral Expression Vector

VPK-214 10 µg
EUR 624.00
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pLenti-RFP-Puro Lentiviral Control Vector

LTV-403 100 µL
EUR 618.00
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW-GFP-LC3 Lentiviral Expression Vector

LTV-801 10 µg
EUR 1204.00
Description: Expression vector contains a fusion of GFP and LC3. A separate GFP control vector is also included.

ESR1 Lentiviral Vector (Human) (pLenti-II)

LV010008 1.0 ug DNA
EUR 316.00

pSMPUW-GFP-Puro Lentiviral Control Vector

LTV-401 10 µg
EUR 618.00
Description: Use this control vector to co-transfect along with lentivirus packaging vectors to make a recombinant control lentivirus.

pSMPUW Universal Lentiviral Expression Vector (Promoterless)

VPK-211 10 µg
EUR 624.00
Description: Clone your gene of interest and a gene-specific promoter into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293T or 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Puro Lentiviral Expression Vector

VPK-215 10 µg
EUR 624.00
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Neo Lentiviral Expression Vector

VPK-216 10 µg
EUR 624.00
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Hygro Lentiviral Expression Vector

VPK-217 10 µg
EUR 624.00
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

pSMPUW-IRES-Blasticidin Lentiviral Expression Vector

VPK-219 10 µg
EUR 624.00
Description: Clone your gene of interest into this Lentiviral Expression Vector, then co-transfect along with lentiviral packaging vectors into a packaging cell line such as 293LTV. This expression vector is compatible with any 2nd or 3rd generation lentiviral packaging system, but due to its design it is best matched with our ViraSafe packaging vectors to produce the highest viral titer.

DPY19L1P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723333 1.0 ug DNA Ask for price

DPY19L1P2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723334 1.0 ug DNA Ask for price

DRD5P1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723353 1.0 ug DNA Ask for price

DRD5P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723357 1.0 ug DNA Ask for price

DRD5P1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723358 1.0 ug DNA Ask for price

DRD5P2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723359 1.0 ug DNA Ask for price

DRD5P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723363 1.0 ug DNA Ask for price

DRD5P2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723364 1.0 ug DNA Ask for price

DSTNP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723383 1.0 ug DNA Ask for price

DSTNP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723387 1.0 ug DNA Ask for price

DSTNP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723388 1.0 ug DNA Ask for price

DSTNP3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723389 1.0 ug DNA Ask for price

DSTNP3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723393 1.0 ug DNA Ask for price

DSTNP3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723394 1.0 ug DNA Ask for price

DTX2P1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723395 1.0 ug DNA Ask for price

DTX2P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723399 1.0 ug DNA Ask for price

DTX2P1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723400 1.0 ug DNA Ask for price

DURS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723401 1.0 ug DNA Ask for price

DURS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723405 1.0 ug DNA Ask for price

DURS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723406 1.0 ug DNA Ask for price

DUSPP Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723407 1.0 ug DNA Ask for price

DUSPP Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723411 1.0 ug DNA Ask for price

DUSPP Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723412 1.0 ug DNA Ask for price

DUTP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723413 1.0 ug DNA Ask for price

DUTP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723417 1.0 ug DNA Ask for price

DUTP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723418 1.0 ug DNA Ask for price

DUTP2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723419 1.0 ug DNA Ask for price

DUTP2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723423 1.0 ug DNA Ask for price

DUTP2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723424 1.0 ug DNA Ask for price

DUTP4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723425 1.0 ug DNA Ask for price

DUTP4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723429 1.0 ug DNA Ask for price

DUTP4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723430 1.0 ug DNA Ask for price

DUTP5 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723431 1.0 ug DNA Ask for price

DUTP5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723435 1.0 ug DNA Ask for price

DUTP5 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723436 1.0 ug DNA Ask for price

DUTP6 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723437 1.0 ug DNA Ask for price

DUTP6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723441 1.0 ug DNA Ask for price

DUTP6 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723442 1.0 ug DNA Ask for price

DUTP7 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723443 1.0 ug DNA Ask for price

DUTP7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723447 1.0 ug DNA Ask for price

DUTP7 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723448 1.0 ug DNA Ask for price

DUTP8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723449 1.0 ug DNA Ask for price

DUTP8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723453 1.0 ug DNA Ask for price

DUTP8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723454 1.0 ug DNA Ask for price

DUX4L8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723455 1.0 ug DNA Ask for price

DUX4L8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723459 1.0 ug DNA Ask for price

DUX4L8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723460 1.0 ug DNA Ask for price

DUX4L10 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723461 1.0 ug DNA Ask for price

DUX4L10 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723465 1.0 ug DNA Ask for price

DUX4L10 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723466 1.0 ug DNA Ask for price

DUX4L11 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723467 1.0 ug DNA Ask for price

DUX4L11 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723471 1.0 ug DNA Ask for price

DUX4L11 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723472 1.0 ug DNA Ask for price

DUX4L14 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723473 1.0 ug DNA Ask for price

DUX4L14 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723477 1.0 ug DNA Ask for price

DUX4L14 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723478 1.0 ug DNA Ask for price

DUX4L16 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723479 1.0 ug DNA Ask for price

DUX4L16 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723483 1.0 ug DNA Ask for price

DUX4L16 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723484 1.0 ug DNA Ask for price

DUX4L17 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723485 1.0 ug DNA Ask for price

DUX4L17 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723489 1.0 ug DNA Ask for price

DUX4L17 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723490 1.0 ug DNA Ask for price

DUX4L18 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723491 1.0 ug DNA Ask for price

DUX4L18 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723495 1.0 ug DNA Ask for price

DUX4L18 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723496 1.0 ug DNA Ask for price

DUX4L19 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723497 1.0 ug DNA Ask for price

DUX4L19 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723501 1.0 ug DNA Ask for price

DUX4L19 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723502 1.0 ug DNA Ask for price

DUXB Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723503 1.0 ug DNA Ask for price

DUXB Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723507 1.0 ug DNA Ask for price

DUXB Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723508 1.0 ug DNA Ask for price

DVL1L1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723509 1.0 ug DNA Ask for price

DVL1L1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723513 1.0 ug DNA Ask for price

DVL1L1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723514 1.0 ug DNA Ask for price

DWS Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723515 1.0 ug DNA Ask for price

DWS Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723519 1.0 ug DNA Ask for price

DWS Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723520 1.0 ug DNA Ask for price

DYNLL1P2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723521 1.0 ug DNA Ask for price

DYNLL1P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723525 1.0 ug DNA Ask for price

DYNLL1P2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723526 1.0 ug DNA Ask for price

DYRK1AIP1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723527 1.0 ug DNA Ask for price

DYRK1AIP1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723531 1.0 ug DNA Ask for price

DYRK1AIP1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723532 1.0 ug DNA Ask for price

DYRK1AIP2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723533 1.0 ug DNA Ask for price

DYRK1AIP2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723537 1.0 ug DNA Ask for price

DYRK1AIP2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723538 1.0 ug DNA Ask for price

DYT2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723539 1.0 ug DNA Ask for price

DYT2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723543 1.0 ug DNA Ask for price

DYT2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723544 1.0 ug DNA Ask for price

DYT4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723545 1.0 ug DNA Ask for price

DYT4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723549 1.0 ug DNA Ask for price

DYT4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723550 1.0 ug DNA Ask for price

DYT7 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723551 1.0 ug DNA Ask for price

DYT7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723555 1.0 ug DNA Ask for price

DYT7 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723556 1.0 ug DNA Ask for price

DYT10 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723557 1.0 ug DNA Ask for price

DYT10 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723561 1.0 ug DNA Ask for price

DYT10 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723562 1.0 ug DNA Ask for price

DYT13 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723563 1.0 ug DNA Ask for price

DYT13 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723567 1.0 ug DNA Ask for price

DYT13 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723568 1.0 ug DNA Ask for price

DYT15 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723569 1.0 ug DNA Ask for price

DYT15 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723573 1.0 ug DNA Ask for price

DYT15 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723574 1.0 ug DNA Ask for price

DYT17 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723575 1.0 ug DNA Ask for price

DYT17 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723579 1.0 ug DNA Ask for price

DYT17 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723580 1.0 ug DNA Ask for price

DYT21 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723581 1.0 ug DNA Ask for price

DYT21 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723585 1.0 ug DNA Ask for price

DYT21 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723586 1.0 ug DNA Ask for price

DYT22 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723587 1.0 ug DNA Ask for price

DYT22 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723591 1.0 ug DNA Ask for price

DYT22 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723592 1.0 ug DNA Ask for price

DYX1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723593 1.0 ug DNA Ask for price

DYX1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723597 1.0 ug DNA Ask for price

DYX1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723598 1.0 ug DNA Ask for price

DYX2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723605 1.0 ug DNA Ask for price

DYX2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723609 1.0 ug DNA Ask for price

DYX2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723610 1.0 ug DNA Ask for price

DYX3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723611 1.0 ug DNA Ask for price

DYX3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723615 1.0 ug DNA Ask for price

DYX3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723616 1.0 ug DNA Ask for price

DYX4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723617 1.0 ug DNA Ask for price

DYX4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723621 1.0 ug DNA Ask for price

DYX4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723622 1.0 ug DNA Ask for price

DYX5 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723623 1.0 ug DNA Ask for price

DYX5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723627 1.0 ug DNA Ask for price

DYX5 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723628 1.0 ug DNA Ask for price

DYX6 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723629 1.0 ug DNA Ask for price

DYX6 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723633 1.0 ug DNA Ask for price

DYX6 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723634 1.0 ug DNA Ask for price

DYX7 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723635 1.0 ug DNA Ask for price

DYX7 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723639 1.0 ug DNA Ask for price

DYX7 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723640 1.0 ug DNA Ask for price

DYX8 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723641 1.0 ug DNA Ask for price

DYX8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723645 1.0 ug DNA Ask for price

DYX8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723646 1.0 ug DNA Ask for price

DYX9 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723647 1.0 ug DNA Ask for price

DYX9 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723651 1.0 ug DNA Ask for price

DYX9 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723652 1.0 ug DNA Ask for price

E2F3P2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723659 1.0 ug DNA Ask for price

E2F3P2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723663 1.0 ug DNA Ask for price

E2F3P2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723664 1.0 ug DNA Ask for price

E2F4P1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723665 1.0 ug DNA Ask for price

E2F4P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723669 1.0 ug DNA Ask for price

E2F4P1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723670 1.0 ug DNA Ask for price

E11S Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723671 1.0 ug DNA Ask for price

E11S Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723675 1.0 ug DNA Ask for price

E11S Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723676 1.0 ug DNA Ask for price

EBM Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723683 1.0 ug DNA Ask for price

EBM Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723687 1.0 ug DNA Ask for price

EBM Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723688 1.0 ug DNA Ask for price

EBR3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723689 1.0 ug DNA Ask for price

EBR3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723693 1.0 ug DNA Ask for price

EBR3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723694 1.0 ug DNA Ask for price

EBR4 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723695 1.0 ug DNA Ask for price

EBR4 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723699 1.0 ug DNA Ask for price

EBR4 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723700 1.0 ug DNA Ask for price

EBVM1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723701 1.0 ug DNA Ask for price

EBVM1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723705 1.0 ug DNA Ask for price

EBVM1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723706 1.0 ug DNA Ask for price

EBVS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723707 1.0 ug DNA Ask for price

EBVS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723711 1.0 ug DNA Ask for price

EBVS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723712 1.0 ug DNA Ask for price

ECA1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723713 1.0 ug DNA Ask for price

ECA1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723717 1.0 ug DNA Ask for price

ECA1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723718 1.0 ug DNA Ask for price

ECEL1P1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723719 1.0 ug DNA Ask for price

ECEL1P1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723723 1.0 ug DNA Ask for price

ECEL1P1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723724 1.0 ug DNA Ask for price

ECEL1P3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723725 1.0 ug DNA Ask for price

ECEL1P3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723729 1.0 ug DNA Ask for price

ECEL1P3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723730 1.0 ug DNA Ask for price

EDDM3DP Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723731 1.0 ug DNA Ask for price

EDDM3DP Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723735 1.0 ug DNA Ask for price

EDDM3DP Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723736 1.0 ug DNA Ask for price

EEC1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723737 1.0 ug DNA Ask for price

EEC1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723741 1.0 ug DNA Ask for price

EEC1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723742 1.0 ug DNA Ask for price

EEC2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723743 1.0 ug DNA Ask for price

EEC2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723747 1.0 ug DNA Ask for price

EEC2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723748 1.0 ug DNA Ask for price

EEF1A1P3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723749 1.0 ug DNA Ask for price
Most of the vaccines beneath improvement for COVID-19 contain the usage of viral vectors. The Brighton Collaboration Profit-Danger Evaluation of Vaccines by Expertise (BRAVATO, previously the Viral Vector Vaccine Security Working Group, V3SWG) working group has ready a standardized template to explain the important thing concerns for the benefit-risk evaluation of viral vector vaccines. It will facilitate key stakeholders to anticipate potential issues of safety and interpret or assess security information. This might additionally assist enhance communication and public acceptance of licensed viral vector vaccines.

Accelerating the Morphogenetic Cycle of the Viral Vector Aedes aegypti Larvae for Quicker Larvicidal Bioassays

Any bioassay to check new chemically synthesized larvicides or phytolarvicides in opposition to Culicidae and extra dangerous mosquito species, comparable to Aedeaegypti and Aedes albopictus, which particularly transmit dengue, yellow fever, chikungunya viral fevers in addition to Zika virus, or Anopheles gambiae, a vector for malaria and philariasis, requires 1000’s of well-developed larvae, ideally on the fourth instar stage. The pure morphogenetic cycle of Aedes spp., within the discipline or within the laboratory, could lengthen to 19 days at room temperature (e.g., 25°C) from the primary everlasting contact between viable eggs and water and the final stage of larval progress or metamorphosis into flying adults. Thus, accelerated sequential molting is fascinating for swifter bioassays of larvicides. We achieved this objective in Aedes aegypti with very restricted strategic and low-cost additions to meals, comparable to coconut water, milk or its casein, yeast extract, and to a lesser extent, glycerol. The naturally wealthy coconut water was glorious for rapidly attaining the inhabitants of instar IV larvae, essentially the most superior one earlier than pupation, saving a couple of week, for subsequent larvicidal bioassays. Diluted milk, as one other meals supply, allowed a good quicker last ecdysis and adults are helpful for mosquito taxonomical objective.

DPF1 siRNA

20-abx914533
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

DPF1 siRNA

20-abx914534
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

DPF1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV700741 1.0 ug DNA
EUR 682.00

DPF1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV700745 1.0 ug DNA
EUR 682.00

DPF1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV700746 1.0 ug DNA
EUR 682.00

Dpf1 ORF Vector (Rat) (pORF)

ORF066188 1.0 ug DNA
EUR 506.00

DPF1 ORF Vector (Human) (pORF)

ORF012873 1.0 ug DNA
EUR 95.00

Dpf1 ORF Vector (Mouse) (pORF)

ORF043301 1.0 ug DNA
EUR 506.00

DPF1 Polyclonal Antibody

30897-100ul 100ul
EUR 252.00

DPF1 Polyclonal Antibody

30897-50ul 50ul
EUR 187.00

DPF1 Blocking Peptide

33R-4344 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DPF1 antibody, catalog no. 70R-8033

DPF1 cloning plasmid

CSB-CL835697HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1164
  • Sequence: ATGGCCACGGTCATCCCTGGCCCCCTGAGCCTAGGCGAGGACTTCTACCGCGAGGCCATCGAGCACTGCCGCAGTTACAACGCGCGCCTGTGCGCCGAGCGCAGCCTGCGACTGCCCTTCCTCGACTCGCAGACCGGCGTGGCCCAGAACAACTGCTACATCTGGATGGAGAAGA
  • Show more
Description: A cloning plasmid for the DPF1 gene.

DPF1 Rabbit pAb

A7349-100ul 100 ul
EUR 308.00

DPF1 Rabbit pAb

A7349-200ul 200 ul
EUR 459.00

DPF1 Rabbit pAb

A7349-20ul 20 ul
EUR 183.00

DPF1 Rabbit pAb

A7349-50ul 50 ul
EUR 223.00

Anti-DPF1 antibody

STJ29488 100 µl
EUR 277.00

Mouse DPF1 shRNA Plasmid

20-abx973997
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

DPF1 Polyclonal Conjugated Antibody

C30897 100ul
EUR 397.00

Human DPF1 shRNA Plasmid

20-abx955392
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

DPF1 Recombinant Protein (Human)

RP038617 100 ug Ask for price

DPF1 Recombinant Protein (Rat)

RP198560 100 ug Ask for price

DPF1 Recombinant Protein (Mouse)

RP129899 100 ug Ask for price

DPF1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV700742 1.0 ug DNA
EUR 682.00

DPF1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV700743 1.0 ug DNA
EUR 740.00

DPF1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV700744 1.0 ug DNA
EUR 740.00

DPF1 Protein Vector (Mouse) (pPB-C-His)

PV173202 500 ng
EUR 603.00

DPF1 Protein Vector (Mouse) (pPB-N-His)

PV173203 500 ng
EUR 603.00

DPF1 Protein Vector (Mouse) (pPM-C-HA)

PV173204 500 ng
EUR 603.00

DPF1 Protein Vector (Mouse) (pPM-C-His)

PV173205 500 ng
EUR 603.00

DPF1 Protein Vector (Rat) (pPB-C-His)

PV264750 500 ng
EUR 603.00

DPF1 Protein Vector (Rat) (pPB-N-His)

PV264751 500 ng
EUR 603.00

DPF1 Protein Vector (Rat) (pPM-C-HA)

PV264752 500 ng
EUR 603.00

DPF1 Protein Vector (Rat) (pPM-C-His)

PV264753 500 ng
EUR 603.00

DPF1 Protein Vector (Human) (pPB-C-His)

PV051489 500 ng
EUR 481.00

DPF1 Protein Vector (Human) (pPB-N-His)

PV051490 500 ng
EUR 481.00

DPF1 Protein Vector (Human) (pPM-C-HA)

PV051491 500 ng
EUR 481.00

DPF1 Protein Vector (Human) (pPM-C-His)

PV051492 500 ng
EUR 481.00

Anti-Neuro-d4 / DPF1 antibody

STJ70314 100 µg
EUR 359.00

Dpf1 sgRNA CRISPR Lentivector set (Mouse)

K4892601 3 x 1.0 ug
EUR 339.00

DPF1 sgRNA CRISPR Lentivector set (Human)

K0626801 3 x 1.0 ug
EUR 339.00

Dpf1 sgRNA CRISPR Lentivector set (Rat)

K6862201 3 x 1.0 ug
EUR 339.00

Zinc Finger Protein Neuro-D4 (DPF1) Antibody

20-abx007172
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Zinc Finger Protein Neuro-D4 (DPF1) Antibody

abx038337-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Zinc Finger Protein Neuro-D4 (DPF1) Antibody

abx122412-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Zinc Finger Protein Neuro-D4 (DPF1) Antibody

abx029594-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Zinc Finger Protein Neuro-D4 (DPF1) Antibody

abx029594-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Polyclonal Neuro-d4 / DPF1 Antibody (C-Term)

AMM06622G 0.1 mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Neuro-d4 / DPF1 (C-Term). This antibody is tested and proven to work in the following applications:

Zinc Finger Protein Neuro-D4 (DPF1) Antibody

20-abx320857
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Dpf1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4892602 1.0 ug DNA
EUR 154.00

Dpf1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4892603 1.0 ug DNA
EUR 154.00

Dpf1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4892604 1.0 ug DNA
EUR 154.00

DPF1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0626802 1.0 ug DNA
EUR 154.00

DPF1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0626803 1.0 ug DNA
EUR 154.00

DPF1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0626804 1.0 ug DNA
EUR 154.00

Dpf1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6862202 1.0 ug DNA
EUR 154.00

Dpf1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6862203 1.0 ug DNA
EUR 154.00

Dpf1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6862204 1.0 ug DNA
EUR 154.00

Dpf1 3'UTR GFP Stable Cell Line

TU155349 1.0 ml Ask for price

Dpf1 3'UTR Luciferase Stable Cell Line

TU105349 1.0 ml Ask for price

Dpf1 3'UTR Luciferase Stable Cell Line

TU203598 1.0 ml Ask for price

Dpf1 3'UTR GFP Stable Cell Line

TU253598 1.0 ml Ask for price

DPF1 3'UTR GFP Stable Cell Line

TU056264 1.0 ml
EUR 2333.00

DPF1 3'UTR Luciferase Stable Cell Line

TU006264 1.0 ml
EUR 2333.00

Rat Zinc finger protein neuro d4(DPF1) ELISA kit

E02Z0006-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Zinc finger protein neuro d4(DPF1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Zinc finger protein neuro d4(DPF1) ELISA kit

E02Z0006-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Zinc finger protein neuro d4(DPF1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Zinc finger protein neuro d4(DPF1) ELISA kit

E02Z0006-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Zinc finger protein neuro d4(DPF1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zinc finger protein neuro d4(DPF1) ELISA kit

E04Z0006-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Zinc finger protein neuro d4(DPF1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zinc finger protein neuro d4(DPF1) ELISA kit

E04Z0006-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Zinc finger protein neuro d4(DPF1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zinc finger protein neuro d4(DPF1) ELISA kit

E04Z0006-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Zinc finger protein neuro d4(DPF1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Zinc finger protein neuro d4(DPF1) ELISA kit

E03Z0006-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Zinc finger protein neuro d4(DPF1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Zinc finger protein neuro d4(DPF1) ELISA kit

E03Z0006-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Zinc finger protein neuro d4(DPF1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Zinc finger protein neuro d4(DPF1) ELISA kit

E03Z0006-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Zinc finger protein neuro d4(DPF1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zinc finger protein neuro d4(DPF1) ELISA kit

E01Z0006-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Zinc finger protein neuro d4(DPF1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zinc finger protein neuro d4(DPF1) ELISA kit

E01Z0006-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Zinc finger protein neuro d4(DPF1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Leave a Reply

Your email address will not be published. Required fields are marked *